Upload: humanfile.fasta

Quick preview of your data:

Header row:

Medtr1g004950.1 | hypothetical protein | LC | chr1:14514-15729 | 20140818

Sequence:

ATGACGTCTTTGAGGAGGTTCAAAAAGGACAAAATAAAATTGTGCGATAAAGGC ... (truncated)

1: We detected the following attributes:

  • File format: FASTA
  • Number of entities in the file: 37

2: Tell us about your file

We had a couple more questions...

  • Sequence Features

    What type of sequence features are in this file?

  • Nucleotides or proteins?

    Does this file contain nucleotides or proteins?

    Nucleotides Proteins
  • The first item (e.g. Medtr1g004950.1) is a: